axiovision image analysis software zen2 (Carl Zeiss)
Carl Zeiss is a verified supplier 
Carl Zeiss manufactures this product 
95
Structured Review
Carl Zeiss
axiovision image analysis software zen2
Axiovision Image Analysis Software Zen2, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 95/100, based on 198 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/zen2/ZEN+Module+Image+Analysis/pm42853007-162-5-10
Average 95 stars, based on 198 article reviews
Axiovision Image Analysis Software Zen2, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 95/100, based on 198 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/zen2/ZEN+Module+Image+Analysis/pm42853007-162-5-10
Average 95 stars, based on 198 article reviews
axiovision image analysis software zen2 - by Bioz Stars,
2026-11
95/100 stars
Images
Related Articles
Software:Article Title: Rhinoscleroma pathogenesis: The type K3 capsule of Klebsiella rhinoscleromatis is a virulence factor not involved in Mikulicz cells formation Article Snippet: .. Images were acquired with the AxioScan.Z1 (Zeiss) using the Article Title: WDR8 is a centriolar satellite and centriole-associated protein that promotes ciliary vesicle docking during ciliogenesis. Article Snippet: Coverslips were mounted on glass slides in Mowiol (EMD Millipore) containing DAPI (4',6-diamidino-2phenylindole). .. Images were acquired as z-stacks using the Zeiss LSM780 (Carl Zeiss, Oberkochen, Germany) confocal system and software ( Article Title: Temporal regulation of epithelium formation mediated by FoxA, MKLP1, MgcRacGAP, and PAR-6 Article Snippet: A #1.5 coverslip (Corning) was added, and nail polish was added at the corners to prevent the coverslip from moving. .. Embryos were scored using Nomarski optics for foregut attachment defects under a Zeiss AxioImager M2 running AxioVision or Article Title: Rosiglitazone reverses high fat diet-induced changes in BMAL1 function in muscle, fat, and liver tissue in mice Article Snippet: .. All images were acquired with an Axio Scope A1 microscope using Confocal:Article Title: Cerebellospinal Neurons Regulate Motor Performance and Motor Learning Article Snippet: For in situ hybridization, RNAscope Fluorescent Multiplex Reagent Kit (ACD) was used according to the manufacturer’s instructions. .. Sections were imaged using a Zeiss LSM 800 confocal microscope and processed (tiles were stitched using “stitch tile” function; slices were Z-projected using “orthogonal projection” function) using FIJI (NIH image) and/or Microscopy:Article Title: Cerebellospinal Neurons Regulate Motor Performance and Motor Learning Article Snippet: For in situ hybridization, RNAscope Fluorescent Multiplex Reagent Kit (ACD) was used according to the manufacturer’s instructions. .. Sections were imaged using a Zeiss LSM 800 confocal microscope and processed (tiles were stitched using “stitch tile” function; slices were Z-projected using “orthogonal projection” function) using FIJI (NIH image) and/or Article Title: Rosiglitazone reverses high fat diet-induced changes in BMAL1 function in muscle, fat, and liver tissue in mice Article Snippet: .. All images were acquired with an Axio Scope A1 microscope using Inverted Microscopy:Article Title: WDR8 is a centriolar satellite and centriole-associated protein that promotes ciliary vesicle docking during ciliogenesis. Article Snippet: Coverslips were mounted on glass slides in Mowiol (EMD Millipore) containing DAPI (4',6-diamidino-2phenylindole). .. Images were acquired as z-stacks using the Zeiss LSM780 (Carl Zeiss, Oberkochen, Germany) confocal system and software ( Recombinant:Article Title: Microbiota-Sourced Purines Support Wound Healing and Mucous Barrier Function Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ki-67 Monoclonal Thermo Fisher Scientific Cat#14-5698-82; RRID: AB_10854564 BiP/GRP78/HSPA5 Novus Biologicals Cat#NBP1-06277; RRID: AB_1556186 E. coli Novus Biologicals Cat#NB200-579; RRID: AB_10002133 Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11034; AB_2576217 Goat anti-Rat IgG (H+L) Cross Adsorbed Secondary Antobody, Alex Fluor 555 Thermo Fisher Scientific Cat#A-21434; RRID: AB_2535855 Chemicals, Peptides, and Recombinant Proteins Acetonitrile (HPLC) Fisher Scientific Cat#A998; CAS: 75- 05-8 Methanol (HPLC) Fisher Scientific Cat#A452; CAS: 67- 56-1 Methanol, Absolute – Acetone free Millipore Sigma Cat#M1775; CAS: 67-56-1 Potassium phosphate monobasic for HPLC, LiChropur Millipore Sigma Cat#57618; CAS: 7778-77-0 Tetrabutylammonium bisulfate Millipore Sigma Cat#86868; CAS: 32503-27-8 Critical Commercial Assays TUNEL Assay Kit – HRP-DAB Abcam Cat#ab206386 Experimental Models: Organisms/Strains Mouse: C57BL/6J The Jackson Laboratory Cat#00664; RRID: IMSR_JAX:000664 Oligonucleotides E. coli rpsL mutagenic oligo: G*T*C*A*GACGAACACGGCATACTTTACGCAGCGCG GAGTTCGGTTTTCTAGGAGTGGTAGTATATACACGA GTACATACGCCACGTTTTTGC This Paper N/A Recombinant DNA pORTMAGE-3 addgene Cat#72678; RRID: Addgene_72678 Software and Algorithms Prism GraphPad https://www.graphpa d.com/scientificsoftware/prism/; RRID: High Performance Liquid Chromatography:Article Title: Microbiota-Sourced Purines Support Wound Healing and Mucous Barrier Function Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ki-67 Monoclonal Thermo Fisher Scientific Cat#14-5698-82; RRID: AB_10854564 BiP/GRP78/HSPA5 Novus Biologicals Cat#NBP1-06277; RRID: AB_1556186 E. coli Novus Biologicals Cat#NB200-579; RRID: AB_10002133 Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11034; AB_2576217 Goat anti-Rat IgG (H+L) Cross Adsorbed Secondary Antobody, Alex Fluor 555 Thermo Fisher Scientific Cat#A-21434; RRID: AB_2535855 Chemicals, Peptides, and Recombinant Proteins Acetonitrile (HPLC) Fisher Scientific Cat#A998; CAS: 75- 05-8 Methanol (HPLC) Fisher Scientific Cat#A452; CAS: 67- 56-1 Methanol, Absolute – Acetone free Millipore Sigma Cat#M1775; CAS: 67-56-1 Potassium phosphate monobasic for HPLC, LiChropur Millipore Sigma Cat#57618; CAS: 7778-77-0 Tetrabutylammonium bisulfate Millipore Sigma Cat#86868; CAS: 32503-27-8 Critical Commercial Assays TUNEL Assay Kit – HRP-DAB Abcam Cat#ab206386 Experimental Models: Organisms/Strains Mouse: C57BL/6J The Jackson Laboratory Cat#00664; RRID: IMSR_JAX:000664 Oligonucleotides E. coli rpsL mutagenic oligo: G*T*C*A*GACGAACACGGCATACTTTACGCAGCGCG GAGTTCGGTTTTCTAGGAGTGGTAGTATATACACGA GTACATACGCCACGTTTTTGC This Paper N/A Recombinant DNA pORTMAGE-3 addgene Cat#72678; RRID: Addgene_72678 Software and Algorithms Prism GraphPad https://www.graphpa d.com/scientificsoftware/prism/; RRID: TUNEL Assay:Article Title: Microbiota-Sourced Purines Support Wound Healing and Mucous Barrier Function Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ki-67 Monoclonal Thermo Fisher Scientific Cat#14-5698-82; RRID: AB_10854564 BiP/GRP78/HSPA5 Novus Biologicals Cat#NBP1-06277; RRID: AB_1556186 E. coli Novus Biologicals Cat#NB200-579; RRID: AB_10002133 Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11034; AB_2576217 Goat anti-Rat IgG (H+L) Cross Adsorbed Secondary Antobody, Alex Fluor 555 Thermo Fisher Scientific Cat#A-21434; RRID: AB_2535855 Chemicals, Peptides, and Recombinant Proteins Acetonitrile (HPLC) Fisher Scientific Cat#A998; CAS: 75- 05-8 Methanol (HPLC) Fisher Scientific Cat#A452; CAS: 67- 56-1 Methanol, Absolute – Acetone free Millipore Sigma Cat#M1775; CAS: 67-56-1 Potassium phosphate monobasic for HPLC, LiChropur Millipore Sigma Cat#57618; CAS: 7778-77-0 Tetrabutylammonium bisulfate Millipore Sigma Cat#86868; CAS: 32503-27-8 Critical Commercial Assays TUNEL Assay Kit – HRP-DAB Abcam Cat#ab206386 Experimental Models: Organisms/Strains Mouse: C57BL/6J The Jackson Laboratory Cat#00664; RRID: IMSR_JAX:000664 Oligonucleotides E. coli rpsL mutagenic oligo: G*T*C*A*GACGAACACGGCATACTTTACGCAGCGCG GAGTTCGGTTTTCTAGGAGTGGTAGTATATACACGA GTACATACGCCACGTTTTTGC This Paper N/A Recombinant DNA pORTMAGE-3 addgene Cat#72678; RRID: Addgene_72678 Software and Algorithms Prism GraphPad https://www.graphpa d.com/scientificsoftware/prism/; RRID: |